View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0802_low_52 (Length: 251)
Name: NF0802_low_52
Description: NF0802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0802_low_52 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 16 - 241
Target Start/End: Complemental strand, 41238871 - 41238646
Alignment:
| Q |
16 |
gtagaaaatatatctgtttgtaactcaatatttacatgatttgttatgatgtaccaatggcatgtgatttaccttaatcattaagaatacagcgattatt |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41238871 |
gtagacaatatatctgtttgtaactcaatatttacatgatttgttatgatgtaccaatggcatgtgatttaccttaatcattaagaatacagcgattatt |
41238772 |
T |
|
| Q |
116 |
ttctaaaattttaaatttttatcacactatttaacgagactttgagacaggaaatcaaggctaaaaaagtttgagaaatagcttttctctgaaatttctc |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41238771 |
ttctaaaatttaaaatttttatcacactatttaacgagactttgagacaggaaatcaaggctaaaaaagtttgagaaatagcttttctctgaaatttctc |
41238672 |
T |
|
| Q |
216 |
attgaggtgttgcttttcggtctctg |
241 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
41238671 |
attgaggtgttgcttttcggtctctg |
41238646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1 times since January 2019
Visitors: 5828