View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0802_low_53 (Length: 251)

Name: NF0802_low_53
Description: NF0802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0802_low_53
NF0802_low_53
[»] chr1 (2 HSPs)
chr1 (151-242)||(9223289-9223380)
chr1 (24-83)||(9223390-9223449)


Alignment Details
Target: chr1 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 151 - 242
Target Start/End: Complemental strand, 9223380 - 9223289
Alignment:
151 aaatgatgatgacgaattaacgatgataattatatatgccgtgtgttttgaacgtaatcgaaattgactttcaatgaccttgtaagtataat 242  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| |||||    
9223380 aaatgatgatgacgaattaacgatgataattatatatgccgtgtgtgttgaacgtaatcgaaattgactttcaacgaccttgtaagaataat 9223289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 24 - 83
Target Start/End: Complemental strand, 9223449 - 9223390
Alignment:
24 gaactaagtaataaactttatttggatttatcaaaataaaaatgtcaaattacaatatta 83  Q
    |||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||    
9223449 gaactaagtaataaactttatttggattaatgaaaataaaaatgtcaaattacaatatta 9223390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 28 times since January 2019
Visitors: 5829