View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0802_low_58 (Length: 247)
Name: NF0802_low_58
Description: NF0802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0802_low_58 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 34688222 - 34688151
Alignment:
| Q |
1 |
ccccaaatcatgcatctcaaccaatcaacgttgtttgtgcctcaccctactactctgtcagtacctccttaa |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34688222 |
ccccaaatcatgcatctcaaccaatcaacgttgtttgtgcctcaccctactactctgtcagtacctccttaa |
34688151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1142 times since January 2019
Visitors: 5826