View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0802_low_59 (Length: 246)
Name: NF0802_low_59
Description: NF0802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0802_low_59 |
 | |
|
| [»] chr5 (3 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 9e-85; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 24 - 246
Target Start/End: Complemental strand, 39124093 - 39123871
Alignment:
| Q |
24 |
agaaacagcttaaacgcacattcaaagtaatagttgttacttgttagtttaggcttctctctaaaccataactttgcaagatgaggtcgatatcaccaag |
123 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||| ||| |||||||||||| || |||||||||||||||||||||||| || ||||||||| |
|
|
| T |
39124093 |
agaaacagcttgaacgcacattcaaagtgatagttgttacttattaatttaggcttctcactgaaccataactttgcaagatgaggttgacatcaccaag |
39123994 |
T |
|
| Q |
124 |
ggtggtaattgacaaggttacccacaaaagtatatgaattaacttattagagtttccaactacaccaannnnnnnnctttaaagagaaattgattaggtt |
223 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39123993 |
ggtggtaattgactaggttacccacaaaagtatatgaattaacttattagagtttccaactacaccaattttttttctttaaagagaaattgattaggtt |
39123894 |
T |
|
| Q |
224 |
gaaacttttccagaagactattt |
246 |
Q |
| |
|
||||||||| ||||||||||||| |
|
|
| T |
39123893 |
gaaactttttcagaagactattt |
39123871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 128 - 188
Target Start/End: Original strand, 38609816 - 38609877
Alignment:
| Q |
128 |
gtaattgacaaggttaccca-caaaagtatatgaattaacttattagagtttccaactacac |
188 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||| ||||||||||| ||||| ||||||||| |
|
|
| T |
38609816 |
gtaattgactaggttacccaacaaaagtatatgacttaacttattaaagttttcaactacac |
38609877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 200 - 232
Target Start/End: Original strand, 38609927 - 38609959
Alignment:
| Q |
200 |
ctttaaagagaaattgattaggttgaaactttt |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38609927 |
ctttaaagagaaattgattaggttgaaactttt |
38609959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1000 times since January 2019
Visitors: 5822