View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0804_low_10 (Length: 322)
Name: NF0804_low_10
Description: NF0804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0804_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 22 - 297
Target Start/End: Complemental strand, 33463240 - 33462965
Alignment:
| Q |
22 |
catcatcaatggctttgtagttctcaaagtgcatattgatgatttcaagtgatctatcttcacaatgtgaaacctgcataataggagcatcagaaaatag |
121 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33463240 |
catcgtcaatggctttgtagttctcaaagtgcatattgatgatttcaagtgatctatcttcacaatgtgaaacctgcataataggagcatcagaaaatag |
33463141 |
T |
|
| Q |
122 |
atgaataaaatcatcaacagcacttggataatattccttctcatctttttctgcatctttttcatcagagttcaagtttgaaactgaactcgatcgatcc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33463140 |
atgaataaaatcatcaacagcacttggataatcttccttctcatctttttctgcatccttttcatcagagttcaagtttgaaactgaactcgatcgatcc |
33463041 |
T |
|
| Q |
222 |
tcggccacctctctgaggataaaactttcaatatcagaaaatatctgatgctcatttaatatctgttcatcatgat |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33463040 |
tcggccacctctctgaggataaaactttcaatatcagaaaatatctgatgctcatttaatatctgttcatcatgat |
33462965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4917 times since January 2019
Visitors: 5753