View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0804_low_12 (Length: 320)
Name: NF0804_low_12
Description: NF0804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0804_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 89 - 218
Target Start/End: Original strand, 42367018 - 42367147
Alignment:
| Q |
89 |
catcattgaaggtggtctaccatagtacttattaatcttattaattttagccctttggtttttgtctataaatgagaaccgttggatctcgcatgcttat |
188 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42367018 |
catcattgaaggtggtctacgatagaccttattaatcttattaattttagccctttagtttttgtctataaatgagaaccgttggatctcgcatgcttat |
42367117 |
T |
|
| Q |
189 |
cgtatcttatagtaaaccaccaataactga |
218 |
Q |
| |
|
||||||||||||||||||||||| |||||| |
|
|
| T |
42367118 |
cgtatcttatagtaaaccaccaacaactga |
42367147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 93 - 207
Target Start/End: Original strand, 1409795 - 1409909
Alignment:
| Q |
93 |
attgaaggtggtctaccatagtacttattaatcttattaattttagccctttggtttttgtctataaatgagaaccgttggatctcgcatgcttatcgta |
192 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||| ||||||||| |||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
1409795 |
attgaaggtggtctaccatagactttattaatctttttaatttgagccctttgatttttgtctataaatgagaaccgttggatcacgcatgtctatcgta |
1409894 |
T |
|
| Q |
193 |
tcttatagtaaacca |
207 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
1409895 |
tcttatagtaaacca |
1409909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5066 times since January 2019
Visitors: 5754