View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0804_low_18 (Length: 265)
Name: NF0804_low_18
Description: NF0804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0804_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 39 - 241
Target Start/End: Complemental strand, 41548333 - 41548124
Alignment:
Q |
39 |
acaaggaatactcgaatccagcaacatac------tatcctcgttaaaagggtaa-taaactttaccttccatcgatcgtgatacgaggctttctagctg |
131 |
Q |
|
|
|||||||||||||||||||||||||||| |||||||||| ||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
41548333 |
acaaggaatactcgaatccagcaacatatatataatatcctcgttgaaagggtaaataaactttaccttccatcgatagtgatacgaggctttctagctg |
41548234 |
T |
 |
Q |
132 |
ctttacctcctgattttattttaagagcgtcacccaatttctcagtaaccacccattcatttaccctacctgcctcaaacaaacctataagtgttgcctt |
231 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41548233 |
ctttacctcctgattttattttaagagcgtcacccaatttctcagtaaccacccattcatttaccctacctgcctcaaacaaacctataagtgttgcctt |
41548134 |
T |
 |
Q |
232 |
ggtcctatgc |
241 |
Q |
|
|
|||||||||| |
|
|
T |
41548133 |
ggtcctatgc |
41548124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University