View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0804_low_25 (Length: 236)
Name: NF0804_low_25
Description: NF0804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0804_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 43939820 - 43939725
Alignment:
| Q |
1 |
ggaaaagagtttaaagatgaacatgttcttgttgttggttctggtaattctggtatggagattgctttagatttggctaattttggtgctaaacct |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43939820 |
ggaaaagagtttaaagatgaacatgttcttgttgttggttctggtaattctggtatggagattgctttagatttggctaattttggtgctaaacct |
43939725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 4 - 65
Target Start/End: Complemental strand, 43927908 - 43927847
Alignment:
| Q |
4 |
aaagagtttaaagatgaacatgttcttgttgttggttctggtaattctggtatggagattgc |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| ||||| |
|
|
| T |
43927908 |
aaagagtttaaagatgaacatgttcttgttgttgggtctgggaattctggtatggaaattgc |
43927847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4659 times since January 2019
Visitors: 5751