View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0804_low_26 (Length: 225)
Name: NF0804_low_26
Description: NF0804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0804_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 39 - 130
Target Start/End: Original strand, 11226960 - 11227051
Alignment:
Q |
39 |
tcaagtgatgagatgtattatgggaaattggttgacatcatagaacttgattactatggtaagctgagggttgtgcttttcaagtgtatttg |
130 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
11226960 |
tcaagtgatgagatgtattatgggaaattggttgacatcatagaacttgattactatggtaagctgagggttgtgcttttcaagtgtgtttg |
11227051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4652 times since January 2019
Visitors: 5751