View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0804_low_27 (Length: 217)
Name: NF0804_low_27
Description: NF0804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0804_low_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 8351517 - 8351655
Alignment:
| Q |
1 |
agtgtattttatatgatgtcgacatataatatatgatgatgttgtctttctcgtgttcgaataacacatttgttttaaaattgtgtgggtaatctcctct |
100 |
Q |
| |
|
||||||||||||||||| || |||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8351517 |
agtgtattttatatgatatcaacatatgatatatgatgatgttgtctttcttgtgttcgaataacacatttgttttaaaattgtgtgggtagtctcctct |
8351616 |
T |
|
| Q |
101 |
ccattcaactatacagttaagtgatcaaatttttaatgtaatct |
144 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8351617 |
ccattcaacta-----ttaagtgatcaaatttttaatgtaatct |
8351655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5003 times since January 2019
Visitors: 5753