View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0804_low_28 (Length: 216)
Name: NF0804_low_28
Description: NF0804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0804_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 4e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 43939796 - 43939884
Alignment:
| Q |
1 |
catgttcatctttaaactcttttccatttttgtacctagttgaatgaattactttccctttgaaattctccaacccttcaaccacaggt |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43939796 |
catgttcatctttaaactcttttccatttttgtacctagttgaatgaattactttccctttgaaattctccaacccttcaaccacaggt |
43939884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 43927887 - 43927944
Alignment:
| Q |
1 |
catgttcatctttaaactcttttccatttttgtacctagttgaatgaattactttccc |
58 |
Q |
| |
|
|||||||||||||||||||||| ||||| || ||| |||||||||||| |||||||| |
|
|
| T |
43927887 |
catgttcatctttaaactctttcccattcttaaacccagttgaatgaatcactttccc |
43927944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University