View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0804_low_30 (Length: 209)
Name: NF0804_low_30
Description: NF0804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0804_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 12869508 - 12869428
Alignment:
| Q |
1 |
tattttttctctgaaggtgttattagatcggatta--agcttcattgtgcttttatgtttgattttcattcatgatggtat |
79 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12869508 |
tattttttctttgaaggtgttattagatcggattataagcttcattgtgcttttatgtttgattttcattcatgatggtat |
12869428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 52 - 132
Target Start/End: Complemental strand, 12869430 - 12869349
Alignment:
| Q |
52 |
tatgtttgattttcattcatgatggtataatgattctatttgtattggtttgtgac-ttagtgtctatgtaacgatgatctt |
132 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||||| ||||| ||||||||||| ||||||||||||| |
|
|
| T |
12869430 |
tatgtttgattttcattcattatggtataatcattctatttgtattggttagtgactttagtgtctatataacgatgatctt |
12869349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5744 times since January 2019
Visitors: 5758