View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0805-14 (Length: 155)
Name: NF0805-14
Description: NF0805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0805-14 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 7e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 7e-75
Query Start/End: Original strand, 8 - 155
Target Start/End: Original strand, 33803891 - 33804038
Alignment:
Q |
8 |
aatttatctaacctaaggtccttgtctccnaaattggaatcaagccatgctgaatccagaggtgaatgcaccatcacgagtgtcgggagctgtctttgca |
107 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33803891 |
aatttatctaacctaaggtccttgtctccaaaattggaatcaagccatgctgaatccagaggtgaatgcaccatcacgagtgtcgggagctgtctttgca |
33803990 |
T |
 |
Q |
108 |
actatcgggaatttaggccattgtaaacggacnccaagcaaatattat |
155 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
33803991 |
actatcgggaatttaggccattgtaaacggacaccaagcaaatattat |
33804038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University