View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0805-17 (Length: 145)
Name: NF0805-17
Description: NF0805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0805-17 |
 |  |
|
[»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 3e-71; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 3e-71
Query Start/End: Original strand, 10 - 145
Target Start/End: Complemental strand, 32812534 - 32812399
Alignment:
Q |
10 |
ggattcaatcttgaacgtatgtcaacagcatatagtatagttgatgacctgttaggatcatacggcccagataacgctttgcatctccatagatgtgtgg |
109 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32812534 |
ggattcaatcttgaacgtatgtcaacagcatatagtatagttgatgacctgttaggatcatacggcccagataacgctttgcatctccatagatgtgtgg |
32812435 |
T |
 |
Q |
110 |
tgattacattaaaactagtgacacgggcaatactat |
145 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
32812434 |
tgattacattaaaactagtgacacgggcaatactat |
32812399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 10 - 134
Target Start/End: Complemental strand, 32830064 - 32829940
Alignment:
Q |
10 |
ggattcaatcttgaacgtatgtcaacagcatatagtatagttgatgacctgttaggatcatacggcccagataacgctttgcatctccatagatgtgtgg |
109 |
Q |
|
|
|||||||||||||||||||| ||||| ||||||| ||| | ||||| || ||||||||||| | ||| || ||||| |||||||||| ||||| || |
|
|
T |
32830064 |
ggattcaatcttgaacgtatatcaaccgcatataaaataatagatgatctattaggatcatatgatttagacaatgctttacatctccatatatgtgcgg |
32829965 |
T |
 |
Q |
110 |
tgattacattaaaactagtgacacg |
134 |
Q |
|
|
|| ||||||||||| ||||||| |
|
|
T |
32829964 |
cgacaacattaaaactgatgacacg |
32829940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University