View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0805-17 (Length: 145)

Name: NF0805-17
Description: NF0805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0805-17
NF0805-17
[»] chr7 (2 HSPs)
chr7 (10-145)||(32812399-32812534)
chr7 (10-134)||(32829940-32830064)


Alignment Details
Target: chr7 (Bit Score: 136; Significance: 3e-71; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 136; E-Value: 3e-71
Query Start/End: Original strand, 10 - 145
Target Start/End: Complemental strand, 32812534 - 32812399
Alignment:
10 ggattcaatcttgaacgtatgtcaacagcatatagtatagttgatgacctgttaggatcatacggcccagataacgctttgcatctccatagatgtgtgg 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32812534 ggattcaatcttgaacgtatgtcaacagcatatagtatagttgatgacctgttaggatcatacggcccagataacgctttgcatctccatagatgtgtgg 32812435  T
110 tgattacattaaaactagtgacacgggcaatactat 145  Q
    ||||||||||||||||||||||||||||||||||||    
32812434 tgattacattaaaactagtgacacgggcaatactat 32812399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 10 - 134
Target Start/End: Complemental strand, 32830064 - 32829940
Alignment:
10 ggattcaatcttgaacgtatgtcaacagcatatagtatagttgatgacctgttaggatcatacggcccagataacgctttgcatctccatagatgtgtgg 109  Q
    |||||||||||||||||||| ||||| |||||||  ||| | ||||| || ||||||||||| |    ||| || ||||| |||||||||| ||||| ||    
32830064 ggattcaatcttgaacgtatatcaaccgcatataaaataatagatgatctattaggatcatatgatttagacaatgctttacatctccatatatgtgcgg 32829965  T
110 tgattacattaaaactagtgacacg 134  Q
     ||  |||||||||||  |||||||    
32829964 cgacaacattaaaactgatgacacg 32829940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 267 times since January 2019
Visitors: 5834