View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0806_low_12 (Length: 329)
Name: NF0806_low_12
Description: NF0806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0806_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 45 - 316
Target Start/End: Complemental strand, 46843577 - 46843306
Alignment:
Q |
45 |
catctacaagaacatcaacaagaccaagaccaacaacttttgactccaatttatcccaacaacgtttgtgttcaccacaaacatgttgtgttctagggct |
144 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
46843577 |
catctacaagaacatcaacaagaccaagaccaacaacttttgactccaatttatcccaacaacgtttgtgttcaccacaaacatgttgtgttatagggct |
46843478 |
T |
 |
Q |
145 |
atttgtttcagaccaaaaaggattcttgaaacaagaaaaaggcttggtatcaagtattgaagtaggactcatcatggtttcagtttcatgaaaacctttt |
244 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46843477 |
atttgtttcagaccaaaaaggattcttgaaacaagaaaaaggcttggtatcaagtattgaagtaggactcatcatggtttcagtttcatgaaaacctttt |
46843378 |
T |
 |
Q |
245 |
gatgtgaacaactttggagaattgaagaaggatgaagtgattttctttgaactagaatcttccattatagta |
316 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46843377 |
gatgtgaacaactttggagaattgaagaaggatgaagtgattttctttgaactagaatcttccattatagta |
46843306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University