View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0806_low_16 (Length: 277)
Name: NF0806_low_16
Description: NF0806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0806_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 60 - 266
Target Start/End: Original strand, 38932474 - 38932684
Alignment:
| Q |
60 |
ggaataatactgtaaagagatgaccccactcaaaaaagatacataatccaaagtggaagatgcgtccacccaatttcatttctaaaaccgtgcgtccaca |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38932474 |
ggaataatactgtaaagagatgaccccactcaaaaaaggtacataatccaaagtggaagatgcgtccacccaatttcatttctaaaaccgtgcgtccaca |
38932573 |
T |
|
| Q |
160 |
gtta----ctctcaatcgttgatcaactcgctcaactcaccatacaagatcacaacaaggagcatccatggtttccgattctcctcacaatctccatcaa |
255 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38932574 |
gttactctctctcaatcgttgatcaactcgctcaactcagcatacaagatcacaacaacgagcatccatggtttccgattctcctcacaatctccatcga |
38932673 |
T |
|
| Q |
256 |
gtctgtttcat |
266 |
Q |
| |
|
|||| |||||| |
|
|
| T |
38932674 |
gtctctttcat |
38932684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 38932366 - 38932409
Alignment:
| Q |
1 |
gcaactatgattggcagttggcacgagacaagtcccttcagtag |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38932366 |
gcaactatgattggcagttggcacgagacaagtcccttcagtag |
38932409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5256 times since January 2019
Visitors: 5755