View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0806_low_18 (Length: 251)
Name: NF0806_low_18
Description: NF0806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0806_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 169
Target Start/End: Original strand, 41231155 - 41231323
Alignment:
| Q |
1 |
cctcaatcttgaaatgccatacgaaactgtttagactagaaaattaggtaatcgaaatttcagaacagcagcggctaaaaccaagaatctaagaagtcat |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41231155 |
cctcaatcttgaaatgccatatgaaactgtttagactagaaaattaggtaatcgaaatttcagaacagcagcggctataaccaagaatctaagaagtcat |
41231254 |
T |
|
| Q |
101 |
ctgaggtagatagtaaccataaccaagaccaagaatatatggctttttgatataagagttctcaatagt |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41231255 |
ctgaggtagatagtaaccataaccaagaccaagaatatatggctttttgatataagagttctcattagt |
41231323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 183 - 236
Target Start/End: Original strand, 41231438 - 41231491
Alignment:
| Q |
183 |
cacacaagaagaacaaattgaaatgtgttgtcacagtcactatcaagtaataat |
236 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41231438 |
cacataagaagaacaaattgaaatgtgttgtcacagtcactatcaagtaataat |
41231491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5756 times since January 2019
Visitors: 5759