View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0806_low_20 (Length: 235)
Name: NF0806_low_20
Description: NF0806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0806_low_20 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 13 - 235
Target Start/End: Original strand, 7162951 - 7163173
Alignment:
| Q |
13 |
attaatttgcttaacatatgaaaaatgttttgatcaagtaacaaacatttttagtaccgattcatattttggctataaaactatgatatactttgacacc |
112 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7162951 |
attaatttgcttaatgtatgaaaaatgttttgatcaagtaacaaacggttttagtaccgattcatattttggctataaaactatgatatactttgacacc |
7163050 |
T |
|
| Q |
113 |
aatggagatcagaataaaatataagatgtttatggttgctttaaaaatattgtagcgagtgataaagaaaagaataccgagcagggtgttggttttgtga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7163051 |
aatggagatcagaataaaatataagatgtttatggttgctttaaaaatattgtagcgagtgataaagaaaagaataccgagcagggtgttggttttgtga |
7163150 |
T |
|
| Q |
213 |
attctctttgtgtagagagtatt |
235 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
7163151 |
attctctttgtgtagagagtatt |
7163173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 198 - 235
Target Start/End: Original strand, 12703800 - 12703837
Alignment:
| Q |
198 |
gtgttggttttgtgaattctctttgtgtagagagtatt |
235 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
12703800 |
gtgttggtttggtgaattctctttgtgcagagagtatt |
12703837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5423 times since January 2019
Visitors: 5757