View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0807_high_8 (Length: 251)
Name: NF0807_high_8
Description: NF0807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0807_high_8 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 9 - 251
Target Start/End: Original strand, 780764 - 781006
Alignment:
| Q |
9 |
agcagagacaaaccgggggatgtttttataatttcaatacatttagggactgtaatgacaccgccccgtatatttagggaccaaaataacgattactcag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
780764 |
agcagagacaaaccgggggatgtttttataatttcaatacatttagggactgtaatgacaccgccccgtatatttagggaccaaaataacgattactcag |
780863 |
T |
|
| Q |
109 |
ctaaaaacacgcagtttagtaatttgtaggactgaaaatcgagtaaaggtactaaaaaccaaattcaaatgattacatggactagacacatacttaaccc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
780864 |
ctaaaaacacgcagtttagtaatttgtaggactgaaaatcgagtaaaggtactaaaaaccaaattcaaatgattacatggactagacacatatttaaccc |
780963 |
T |
|
| Q |
209 |
taagaaaatgtccttgttacatatatggcgtcattcgatacat |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
780964 |
taagaaaatgtccttgttacatatatggcgtcattcgatacat |
781006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 27 - 68
Target Start/End: Original strand, 3496403 - 3496444
Alignment:
| Q |
27 |
gatgtttttataatttcaatacatttagggactgtaatgaca |
68 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| || ||||| |
|
|
| T |
3496403 |
gatgtttttataatttcaatacatttagagactatagtgaca |
3496444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4609 times since January 2019
Visitors: 5751