View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0807_low_11 (Length: 346)
Name: NF0807_low_11
Description: NF0807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0807_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 213 - 330
Target Start/End: Complemental strand, 6130160 - 6130043
Alignment:
| Q |
213 |
gcccggtaaaatttattcttagtggtattggtccttgaatatgtgaaaaatttaattaaatcctccaaaaattaagactaaaacgaagactgctgtgaca |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6130160 |
gcccggtaaaatttattcttagtggtattggtccttgaatatgtgaaaaatttaattaaatcctccaaaaattaagactaaaacgaagactgctgtgaca |
6130061 |
T |
 |
| Q |
313 |
aattttactatgagaaga |
330 |
Q |
| |
|
||||||| ||||| |||| |
|
|
| T |
6130060 |
aattttaatatgaaaaga |
6130043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University