View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0807_low_11 (Length: 346)

Name: NF0807_low_11
Description: NF0807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0807_low_11
NF0807_low_11
[»] chr4 (1 HSPs)
chr4 (213-330)||(6130043-6130160)


Alignment Details
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 213 - 330
Target Start/End: Complemental strand, 6130160 - 6130043
Alignment:
213 gcccggtaaaatttattcttagtggtattggtccttgaatatgtgaaaaatttaattaaatcctccaaaaattaagactaaaacgaagactgctgtgaca 312  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6130160 gcccggtaaaatttattcttagtggtattggtccttgaatatgtgaaaaatttaattaaatcctccaaaaattaagactaaaacgaagactgctgtgaca 6130061  T
313 aattttactatgagaaga 330  Q
    ||||||| ||||| ||||    
6130060 aattttaatatgaaaaga 6130043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University