View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0807_low_13 (Length: 322)
Name: NF0807_low_13
Description: NF0807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0807_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 9722869 - 9723135
Alignment:
| Q |
1 |
ttatttgagtaagtatagagagatggaaggtgaaaagagtgctatgattggtaggagtgatcaaagagatgggaatgttggtgaggatagtggtggagtt |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||| || ||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9722869 |
ttatttgagtaagtatagggagatggaaggagagaagagtgctatgattggtaggagtgatcagagagatgggaatgttggtgagggtagtggtggagtt |
9722968 |
T |
|
| Q |
101 |
tatggtcatggagttggagttccatcttctatgatgatgatgatgggacataatatgtatggatctgggagtggatcaccatcttctggaaggagtactc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9722969 |
tatggtcatggagttggagttccatcttctatgatgatgatgatgggacataatatgtatggatctgggagtggatcgccatcttctggaaggagtactc |
9723068 |
T |
|
| Q |
201 |
gatagcagagactaatctctcgagtcagataagatcataatgagcaggaaacttctgtcttaagaat |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9723069 |
gatagcagagactaatctctcgagtcagataagatcataatgagcagaaaacttctgtcttaagaat |
9723135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4737 times since January 2019
Visitors: 5752