View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0807_low_14 (Length: 317)
Name: NF0807_low_14
Description: NF0807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0807_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 32 - 158
Target Start/End: Complemental strand, 31607027 - 31606901
Alignment:
| Q |
32 |
tccaacccatccataagaaccctgcacctccaagcatgtgaattatgttatttggtggaaaattttgtctatcatttgaagttcttggaccaacctgcca |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31607027 |
tccaacccatccataagaaccctgcacctccaagcatgtgaattatgttatttggtggaaaattttgtctatcatttgaagttcttggaccaacctgcca |
31606928 |
T |
 |
| Q |
132 |
ttcatcaacattaatcagaagtttaat |
158 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
31606927 |
ttcatcaacattaatcagaagtttaat |
31606901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 253 - 307
Target Start/End: Complemental strand, 31606867 - 31606813
Alignment:
| Q |
253 |
gcaaaattttacttgaatttgtaaagttttgaaataaaccataattttagtataa |
307 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31606867 |
gcaaaattttacttgagcttgtaaagttttgaaataaaccataattttagtataa |
31606813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 6 - 38
Target Start/End: Complemental strand, 48767521 - 48767489
Alignment:
| Q |
6 |
accatggcacttcttctcatagtagctccaacc |
38 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
48767521 |
accaaggcacttcttctcatagtagctccaacc |
48767489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University