View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0807_low_15 (Length: 313)
Name: NF0807_low_15
Description: NF0807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0807_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 72 - 229
Target Start/End: Complemental strand, 3294046 - 3293889
Alignment:
Q |
72 |
gagcagagagagcggagggaggatggatcagttgtgtcagcgtggaggatggggagagacggtggtgggttgggctttgaagcccattgaagagtttggg |
171 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3294046 |
gagcagagagagcggagggaggatggatcagttgtgtcagcgtggaggatggggagagacggtggtgggttgggctttgaagcccattgaagagtttggg |
3293947 |
T |
 |
Q |
172 |
ctagttttgttgggcttcggcccgcgatggctatggaagtgagaggagaggatgatgt |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3293946 |
ctagttttgttgggcttcggcccgcgatggctatggaagtgagaggagaggatgatgt |
3293889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4664 times since January 2019
Visitors: 5751