View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0807_low_15 (Length: 313)

Name: NF0807_low_15
Description: NF0807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0807_low_15
NF0807_low_15
[»] chr7 (1 HSPs)
chr7 (72-229)||(3293889-3294046)


Alignment Details
Target: chr7 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 72 - 229
Target Start/End: Complemental strand, 3294046 - 3293889
Alignment:
72 gagcagagagagcggagggaggatggatcagttgtgtcagcgtggaggatggggagagacggtggtgggttgggctttgaagcccattgaagagtttggg 171  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3294046 gagcagagagagcggagggaggatggatcagttgtgtcagcgtggaggatggggagagacggtggtgggttgggctttgaagcccattgaagagtttggg 3293947  T
172 ctagttttgttgggcttcggcccgcgatggctatggaagtgagaggagaggatgatgt 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3293946 ctagttttgttgggcttcggcccgcgatggctatggaagtgagaggagaggatgatgt 3293889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University