View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0807_low_16 (Length: 283)
Name: NF0807_low_16
Description: NF0807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0807_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 58 - 240
Target Start/End: Complemental strand, 36216888 - 36216706
Alignment:
Q |
58 |
agttttatgttgcggtatccagagtgacttcaagaaagggtctgaagtttttgattttggacgaggataacaagttgtgcacgtcggcatcaaatgtggt |
157 |
Q |
|
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
36216888 |
agttgtatgttgcggtatccatagtgacttcaagaaagggtctgaagtttttgactttggacgaggataacaagttgtgcacatcggcatcaaatgtggt |
36216789 |
T |
 |
Q |
158 |
ttactgggaagtttttgacaatgtttaaaagttgcacccctatactttctcagattgatgtagtttatcagtagtgaattcat |
240 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36216788 |
ttacagggaagtttttgacaatgtttaaaagttgcatccctatactttctcagattgatgtagtttatcagtagtgaattcat |
36216706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University