View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0807_low_17 (Length: 278)
Name: NF0807_low_17
Description: NF0807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0807_low_17 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 93 - 278
Target Start/End: Complemental strand, 54980237 - 54980051
Alignment:
| Q |
93 |
caaagttcaaaccttgttaactaacataatcactaatttactaacatttgctgataaaaacaaattttagaactataagaagtttaagtctgcagttcaa |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
54980237 |
caaagttcaaaccttgttaactaacataatcactaatttactaacatttgctgataaaaacaaattttagaattataagaagtttaagtctgcagttcaa |
54980138 |
T |
 |
| Q |
193 |
tccctgata---actaacataaccaccaataactaatatacaaatttacatactgatgatgtccatctcatttggcattcaaaacatgt |
278 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
54980137 |
tccctgataactactaacataaccaccaataactaatatacaaatttacatactgatga--gcctcctcatttggcattcaaaacatgt |
54980051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University