View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0807_low_18 (Length: 270)

Name: NF0807_low_18
Description: NF0807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0807_low_18
NF0807_low_18
[»] chr8 (1 HSPs)
chr8 (105-258)||(3209915-3210068)


Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 105 - 258
Target Start/End: Original strand, 3209915 - 3210068
Alignment:
105 tttaaagcaaataggttttcagctttggggttaggaagtgggatatatagtagaaatggaacgtgtggagaggaaaatgttttaaaataagaaggatagt 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3209915 tttaaagcaaataggttttcagctttggggttaggaagtgggatatatagtagaaatggaacgtgtggagaggaaaatgttttaaaataagaaggatagt 3210014  T
205 gcaagtggagtttcnnnnnnnnagtataaaataaaatttgagttttgtgatatt 258  Q
    ||||||||||||||        ||||||||||||||||||||||||||||||||    
3210015 gcaagtggagtttcttttttttagtataaaataaaatttgagttttgtgatatt 3210068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University