View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0807_low_18 (Length: 270)
Name: NF0807_low_18
Description: NF0807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0807_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 105 - 258
Target Start/End: Original strand, 3209915 - 3210068
Alignment:
Q |
105 |
tttaaagcaaataggttttcagctttggggttaggaagtgggatatatagtagaaatggaacgtgtggagaggaaaatgttttaaaataagaaggatagt |
204 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3209915 |
tttaaagcaaataggttttcagctttggggttaggaagtgggatatatagtagaaatggaacgtgtggagaggaaaatgttttaaaataagaaggatagt |
3210014 |
T |
 |
Q |
205 |
gcaagtggagtttcnnnnnnnnagtataaaataaaatttgagttttgtgatatt |
258 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
3210015 |
gcaagtggagtttcttttttttagtataaaataaaatttgagttttgtgatatt |
3210068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University