View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0807_low_19 (Length: 253)

Name: NF0807_low_19
Description: NF0807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0807_low_19
NF0807_low_19
[»] chr5 (1 HSPs)
chr5 (57-121)||(31923785-31923849)


Alignment Details
Target: chr5 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 57 - 121
Target Start/End: Original strand, 31923785 - 31923849
Alignment:
57 gcatcgcggcggaaatgacccgggtccacctagaaaccttcttggccgatctacggagacctttg 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
31923785 gcatcgcggcggaaatgacccgggtccacctagaaaccttcttggccaatctacggagacctttg 31923849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University