View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0807_low_20 (Length: 251)

Name: NF0807_low_20
Description: NF0807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0807_low_20
NF0807_low_20
[»] chr6 (1 HSPs)
chr6 (9-251)||(780764-781006)
[»] chr1 (1 HSPs)
chr1 (27-68)||(3496403-3496444)


Alignment Details
Target: chr6 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 9 - 251
Target Start/End: Original strand, 780764 - 781006
Alignment:
9 agcagagacaaaccgggggatgtttttataatttcaatacatttagggactgtaatgacaccgccccgtatatttagggaccaaaataacgattactcag 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
780764 agcagagacaaaccgggggatgtttttataatttcaatacatttagggactgtaatgacaccgccccgtatatttagggaccaaaataacgattactcag 780863  T
109 ctaaaaacacgcagtttagtaatttgtaggactgaaaatcgagtaaaggtactaaaaaccaaattcaaatgattacatggactagacacatacttaaccc 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
780864 ctaaaaacacgcagtttagtaatttgtaggactgaaaatcgagtaaaggtactaaaaaccaaattcaaatgattacatggactagacacatatttaaccc 780963  T
209 taagaaaatgtccttgttacatatatggcgtcattcgatacat 251  Q
    |||||||||||||||||||||||||||||||||||||||||||    
780964 taagaaaatgtccttgttacatatatggcgtcattcgatacat 781006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 27 - 68
Target Start/End: Original strand, 3496403 - 3496444
Alignment:
27 gatgtttttataatttcaatacatttagggactgtaatgaca 68  Q
    |||||||||||||||||||||||||||| |||| || |||||    
3496403 gatgtttttataatttcaatacatttagagactatagtgaca 3496444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 4708 times since January 2019
Visitors: 5752