View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0808_high_18 (Length: 353)
Name: NF0808_high_18
Description: NF0808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0808_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 3 - 270
Target Start/End: Original strand, 931287 - 931554
Alignment:
Q |
3 |
tgatgattgtgtccgggaaatgatgtcaattgaacaaactcctctgtgtaagggagataaggatgtagaagttaatatcactgagtgcaaaaattctggc |
102 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
931287 |
tgatgattgtgcccgggaaatgatgtcaattgaacaaactcctctgtgtaagggagataaggatgtagaagttaatatcactgagtgcaaaaattctggc |
931386 |
T |
 |
Q |
103 |
aaagctttgatggtgttagatttcggtgaggatgatgtcactgagagtgccagctcctttggtgatacaggttcaggctcggagaatgctgtaactgctt |
202 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
931387 |
aaagctttgatggtgttagatttcggtgaggatgatgtcactgagagtgccagctcctttggtgatacaggttcaggctcggagaatgctgtaactgctt |
931486 |
T |
 |
Q |
203 |
cctacggtgatccagaagttgaatcacaaatgtcttctgacagtgcattctcatcaatgtgtgatgat |
270 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
931487 |
cctacggtgatccagaagttgaatcacaaatgtcttctgacagtgcattctcatcaatgtgtgatgat |
931554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University