View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0808_high_19 (Length: 345)
Name: NF0808_high_19
Description: NF0808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0808_high_19 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 8e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 3 - 176
Target Start/End: Original strand, 931287 - 931460
Alignment:
| Q |
3 |
tgatgattgtgtccgggaaatgatgtcaattgaacaaactcctctgtgtaagggagataaggatgtagaagttaatatcactgagtgcaaaaattctggc |
102 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
931287 |
tgatgattgtgcccgggaaatgatgtcaattgaacaaactcctctgtgtaagggagataaggatgtagaagttaatatcactgagtgcaaaaattctggc |
931386 |
T |
 |
| Q |
103 |
aaagctttgatggtgttagatttcggtgaggatgatgtcactgagagtgccagctcctttggtgacacaggttc |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
931387 |
aaagctttgatggtgttagatttcggtgaggatgatgtcactgagagtgccagctcctttggtgatacaggttc |
931460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 276 - 345
Target Start/End: Complemental strand, 8646905 - 8646836
Alignment:
| Q |
276 |
atcataataaacctctgattaacaaacctcattcacatctcctttgtccttccattgacttttaataaac |
345 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||| |||||| |||||||||| ||||| ||| ||||||| |
|
|
| T |
8646905 |
atcataataaacctttgattaacaaaactcattctcatctcatttgtccttctattgaatttgaataaac |
8646836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University