View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0808_high_25 (Length: 299)
Name: NF0808_high_25
Description: NF0808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0808_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 13 - 293
Target Start/End: Original strand, 34761405 - 34761689
Alignment:
| Q |
13 |
atactagtaaaaaagaacttcaataatacttttcattaacattattcctataaatttcattttctcaaacatattttaaaaaattcaaatattgttcatg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
| T |
34761405 |
atactagtaaaaaagaacttcaataatacttttcattaacattattcctataaatttcattttctcaaacatatttaaaaaaattcaaatattgttcacg |
34761504 |
T |
 |
| Q |
113 |
tatataaacacaagataattactttgataatgaaacacaag----atagttacaagagcgagctaatctatgaaatgtgaaatttcaagagtactttgag |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| || | | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34761505 |
tatataaacacaagataattactttgataatgaaacacaagatatatagatatatcaacgagctaatctatgaaatgtgaaatttcaagagtactttgag |
34761604 |
T |
 |
| Q |
209 |
aatgaccaagtaaaatacattattgtccctagagatggatagatccctcttgccttctaagtatatgcttttatagccttctgag |
293 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34761605 |
aatgaccaagtaaaatacattgttgtccctagaaatggatagatccctcttgccttctaagtatatgcttttatagccttatgag |
34761689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University