View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0808_high_32 (Length: 280)
Name: NF0808_high_32
Description: NF0808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0808_high_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 19 - 199
Target Start/End: Complemental strand, 7253590 - 7253412
Alignment:
| Q |
19 |
cagagaccagaaataggttgcaagtaattgattggtccttcttatcaaattatgacacaactaccacgtttattacatataggtaggtgaccatatgaca |
118 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7253590 |
cagaaaccagaaataggttgcaagtaattgattg-tccttcttatcaaattatgacacaactaccacgtttattacatataggtaggtgaccatatgaca |
7253492 |
T |
|
| Q |
119 |
gataaatgaataagacaatatatannnnnnngaaagagaataactatagacttttactacatgactgaaatttaatttaaa |
199 |
Q |
| |
|
||||||||||||||||||| | | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7253491 |
gataaatgaataagacaat-tttttttttttgaaagagaataactatagacttttactacatgactgaaatttaatttaaa |
7253412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1210 times since January 2019
Visitors: 5828