View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0808_high_35 (Length: 274)
Name: NF0808_high_35
Description: NF0808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0808_high_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 4 - 242
Target Start/End: Original strand, 18335882 - 18336121
Alignment:
| Q |
4 |
aatcatttcatcatgctattattcgatccttggtcaaggtttggaagagtttagcttcgtttaaggttcaggtttt-ctcgtggctattgtttatgaata |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
18335882 |
aatcatttcatcatgctattattcgatccttggtcaaggtttggaagagtttagcttcgtttaaggttcaggtttttctcgtggccattgtttatgaata |
18335981 |
T |
 |
| Q |
103 |
aagttcaaactcgtgttaatctcttaagatgcagtgttttggtcgactaaaccgatacaacatgttgtttttattgttacctaggttgaatcgatcgatc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18335982 |
aagttcaaactcgtgttaatctcttaagatgcagtgttttggtcgactaaaccgatacaacatgttgtttttattgttacccaggttgaatcgatcgatc |
18336081 |
T |
 |
| Q |
203 |
atttgtttgttcattattatcctatcgtgtccagagtgtg |
242 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18336082 |
atttgtctgttcattattatcctatcgtgtccagagtgtg |
18336121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University