View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0808_high_45 (Length: 251)
Name: NF0808_high_45
Description: NF0808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0808_high_45 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 8 - 251
Target Start/End: Original strand, 18335275 - 18335521
Alignment:
| Q |
8 |
gagcagagattctagttgcataaaatgaacatataaatttgttaaaaagaattaaattagattagagtgggtcctatatgtgtgggggttcagggcttat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18335275 |
gagcagagattctagttgcataaaatgaacatataaatttgttaaaaagaattaaattagattagagtgggtcctatatgtgtgggggttcagggcttat |
18335374 |
T |
|
| Q |
108 |
tccgtgggtataaagggtgtttgaaattgtagaggaatgttatgttatccatt---tacattatttcaattttgctnnnnnnngaagaagaaaattacaa |
204 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| || | |||||||||||||||||| ||||||||||| ||| | |
|
|
| T |
18335375 |
tccgcgggtataaagggtgtttgaaattgtagaggaatgttatgttatcctttacattcattatttcaattttgctaaaaaaagaagaagaaaaatacta |
18335474 |
T |
|
| Q |
205 |
attatgaacgaggtaggtatcttccaaataatttggaatcaaacatt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18335475 |
attatgaacgaggtaggtatcttccaaataatttggaatcaaacatt |
18335521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 38 times since January 2019
Visitors: 5846