View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0808_high_47 (Length: 250)
Name: NF0808_high_47
Description: NF0808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0808_high_47 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 136 - 250
Target Start/End: Complemental strand, 41239112 - 41238998
Alignment:
| Q |
136 |
cgttggtcatatcttttagtttggtaataatttttgtttgataagactcataaaagtttgtaataattcaaattttttgttgcctaaaggctataattta |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41239112 |
cgttggtcatatcttttagtttggtaataatttttgtttgataaaactcataaaagtttgtaataattcaaattttttgttgcctaaaggctataattta |
41239013 |
T |
|
| Q |
236 |
aattcgatttatcat |
250 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
41239012 |
aattcgatttatcat |
41238998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 73
Target Start/End: Complemental strand, 41239219 - 41239175
Alignment:
| Q |
28 |
atgtttttaacaatgtattcgattgatttgaatgattacaattttt |
73 |
Q |
| |
|
||||||||||| |||||| |||| |||||||||||||||||||||| |
|
|
| T |
41239219 |
atgtttttaaccatgtat-cgatcgatttgaatgattacaattttt |
41239175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 21 times since January 2019
Visitors: 5846