View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0808_high_48 (Length: 213)
Name: NF0808_high_48
Description: NF0808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0808_high_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 43699114 - 43699241
Alignment:
Q |
1 |
cacttgttatagcctttcacaaattcaacccagtttattccattttcatcagaaatgaaaaattgatcaactaaagatgaacctaagtgatccaataaca |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43699114 |
cacttgttatagcctttcacaaattcaacccagtttattccattatcatcagaaatgaaaaattgatcaactaaagatgaacctaagtgatccaataaca |
43699213 |
T |
 |
Q |
101 |
gtggcaacgaatcagttgtgttctcggt |
128 |
Q |
|
|
|||||||||||||||||||||||||||| |
|
|
T |
43699214 |
gtggcaacgaatcagttgtgttctcggt |
43699241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 39526542 - 39526431
Alignment:
Q |
1 |
cacttgttatagcctttcacaaattcaacccagtttattccattttcatcagaaatgaaaaattgatcaactaaagatgaacctaagtgatccaataaca |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39526542 |
cacttgttatagcctttcacaaattcaacccaatttattccatttgcatcagatatgaaaaattgatcaactaaagatgaacctaagtgatccaataaca |
39526443 |
T |
 |
Q |
101 |
gtggcaacgaat |
112 |
Q |
|
|
||| ||||||| |
|
|
T |
39526442 |
ctggaaacgaat |
39526431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 282 times since January 2019
Visitors: 5834