View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0808_low_19 (Length: 404)

Name: NF0808_low_19
Description: NF0808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0808_low_19
NF0808_low_19
[»] chr4 (1 HSPs)
chr4 (29-287)||(35173135-35173393)


Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 29 - 287
Target Start/End: Original strand, 35173135 - 35173393
Alignment:
29 acatattatgaagacaaaaatgtttacgccctaacaaaaataacgattaatggattgtggagctaagaatgtaacttaagacaaagtcacgcatatcccc 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| ||||||||||||||||||||||||||||||||||||    
35173135 acatattatgaagacaaaaatgtttacgccctaacaaaaataacggttaatggactgtggagccaagaatgtaacttaagacaaagtcacgcatatcccc 35173234  T
129 taactatagctaccacacatcttatatttaagttttaaaaaagtaacttaaatataggttttctatggacaaaagagaagaaggaccaaaaattattatt 228  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||    
35173235 taactatagctaccacacatcttatatttaagttttaaaaaagtaacttaaatataggttttctatggataaaagagaagatggaccaaaaattattatt 35173334  T
229 ttacgatgatnnnnnnnncttgcatatccaatagttaaggttttaaattaaaattaagg 287  Q
    ||||||||||        |||||||||||||||||||||||||||||||||||||||||    
35173335 ttacgatgataaaaaaaacttgcatatccaatagttaaggttttaaattaaaattaagg 35173393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 23 times since January 2019
Visitors: 5829