View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0808_low_28 (Length: 336)
Name: NF0808_low_28
Description: NF0808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0808_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 91; Significance: 5e-44; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 69 - 250
Target Start/End: Complemental strand, 40405660 - 40405479
Alignment:
Q |
69 |
cagagactaagcacccttcttgcattttacaatattatatgaaattgaaagtttaggttaagannnnnnnnnnnnnnnnnnnnnnnnncccggtcatgga |
168 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
T |
40405660 |
cagagactaagcacccttcttgcattttacaatattatatgaaattgatagtttaggttaagattttttctttttcaatttttattttcccggtcatgga |
40405561 |
T |
 |
Q |
169 |
tcccatgttaaaatcagactttgctaccagcacctccacctgcacgattggaatcggttccaatcttcacaacatcaattat |
250 |
Q |
|
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
T |
40405560 |
tcccatgttaaaatcagactttgctaccggcacctccacctgcacgattgggatctgttccaatcttcacaacatcaattat |
40405479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University