View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0808_low_32 (Length: 308)

Name: NF0808_low_32
Description: NF0808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0808_low_32
NF0808_low_32
[»] chr1 (1 HSPs)
chr1 (17-149)||(38932640-38932772)


Alignment Details
Target: chr1 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 17 - 149
Target Start/End: Complemental strand, 38932772 - 38932640
Alignment:
17 aattgcggttaggtgaaattgtggttaaaatgaaacttggtgtttatgatagggaatagtgaaagttgaattgagtaaataaagagaaatgaaacagact 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |||||    
38932772 aattgcggttaggtgaaattgtggttaaaatgaaacttggtgtttatgatagggaatagtgaaagttgaattgaataaatagagagaaatgaaagagact 38932673  T
117 tgatggagattgtgaggagaatcggaaaccatg 149  Q
     ||||||||||||||||||||||||||||||||    
38932672 cgatggagattgtgaggagaatcggaaaccatg 38932640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University