View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0808_low_32 (Length: 308)
Name: NF0808_low_32
Description: NF0808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0808_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 17 - 149
Target Start/End: Complemental strand, 38932772 - 38932640
Alignment:
Q |
17 |
aattgcggttaggtgaaattgtggttaaaatgaaacttggtgtttatgatagggaatagtgaaagttgaattgagtaaataaagagaaatgaaacagact |
116 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| ||||| |
|
|
T |
38932772 |
aattgcggttaggtgaaattgtggttaaaatgaaacttggtgtttatgatagggaatagtgaaagttgaattgaataaatagagagaaatgaaagagact |
38932673 |
T |
 |
Q |
117 |
tgatggagattgtgaggagaatcggaaaccatg |
149 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
38932672 |
cgatggagattgtgaggagaatcggaaaccatg |
38932640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1056 times since January 2019
Visitors: 5824