View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0808_low_39 (Length: 290)
Name: NF0808_low_39
Description: NF0808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0808_low_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 61 - 248
Target Start/End: Original strand, 4510488 - 4510675
Alignment:
| Q |
61 |
ataaagaggaaggattcttgaagtacttaggaattggcctgagaagaacattcaagtcattgttgtaactgacggagagcggatcttgggacttggggat |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4510488 |
ataaagaggaaggattcttgaagtacttaggaattggcctgagaagaacattcaagtcattgttgtaactgacggagagcggatcttgggacttggggat |
4510587 |
T |
 |
| Q |
161 |
cttggttgtcaagtaatttctcttatatttgattgcaaatattatgatcattatattcatatgatctgacactgtaatatctcctttg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4510588 |
cttggttgtcaagtaatttctcttatatttgattgcaaatattatgatcattatattcatatgatctgacactgtaatatctcctttg |
4510675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 110 - 165
Target Start/End: Complemental strand, 43208419 - 43208364
Alignment:
| Q |
110 |
attcaagtcattgttgtaactgacggagagcggatcttgggacttggggatcttgg |
165 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||| || ||||| || |||||||| |
|
|
| T |
43208419 |
attcaagttattgttgtaactgacggtgagcggattttaggactcggagatcttgg |
43208364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 71 - 179
Target Start/End: Complemental strand, 43434060 - 43433952
Alignment:
| Q |
71 |
aggattcttgaagtacttaggaattggcctgagaagaacattcaagtcattgttgtaactgacggagagcggatcttgggacttggggatcttggttgtc |
170 |
Q |
| |
|
||||||| |||||||| || || |||||||||||||||||||||||||| || |||||||||||||| ||||||||||| ||||||||||| ||||||| |
|
|
| T |
43434060 |
aggattcaagaagtactgagaaactggcctgagaagaacattcaagtcatagtcgtaactgacggagaacggatcttgggtcttggggatctaggttgtc |
43433961 |
T |
 |
| Q |
171 |
aagtaattt |
179 |
Q |
| |
|
| ||||||| |
|
|
| T |
43433960 |
aggtaattt |
43433952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University