View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0808_low_40 (Length: 281)
Name: NF0808_low_40
Description: NF0808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0808_low_40 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 12 - 252
Target Start/End: Original strand, 36222370 - 36222610
Alignment:
| Q |
12 |
agagagctcattttgaatgacatttgaaattccgagaaccaattcaaacatcaaaaacctactatgactatgttgctgaaatatgatgaacttgatttaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36222370 |
agagagctcattttgaatgacatttgaaattccgagaaccaattcaaacatcaaaaacctactatgactatgttgctgaaatatgatgaacttgatttaa |
36222469 |
T |
|
| Q |
112 |
ttttgtctttgcagtattagttgtgaagtgggaagaaataaaagcaactaaactaagatatgccannnnnnnnatggtgaaaaaagttgaatgtgtatat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36222470 |
ttttgtctttgcagtattagttgtgaagtaggaagaaataaaagcaactaaactaagatatgccattttttttatggtgaaaaaagttgaatgtgtatat |
36222569 |
T |
|
| Q |
212 |
gaactgaagaacctaccaagatagccccaagagggtcaagc |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36222570 |
gaactgaagaacctaccaagatagccccaagagggtcaagc |
36222610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 482 times since January 2019
Visitors: 5838