View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0808_low_52 (Length: 259)
Name: NF0808_low_52
Description: NF0808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0808_low_52 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 4 - 230
Target Start/End: Original strand, 31912430 - 31912663
Alignment:
| Q |
4 |
actaaaatgacgacttctttcctattcagaaactaaac-gactcatcacccaatgtttatacttctagtgatattttacaattagaccattattagtgtg |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31912430 |
actaaaatgacgacttctttcctattcagaaactaaagtgactgatcatccaatgtttatacttctagtgatattttacaattagaccattataagtgtg |
31912529 |
T |
|
| Q |
103 |
agaagatattttcattggacggtgctcgggta------tagatgtagatgtttgtttgaatggctaacatttttagacacgttattagaagcattaaaaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31912530 |
agaagatattttcattggacggtgctcgggtatagatgtagatgtagatgtttgtttgaatggctaacatttttagacacgttattagaagcattaaaaa |
31912629 |
T |
|
| Q |
197 |
gatgggacacagagattttcttttttgagggaat |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
31912630 |
gatgggacacagagattttcttttttgagggaat |
31912663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 40
Target Start/End: Original strand, 5080343 - 5080379
Alignment:
| Q |
4 |
actaaaatgacgacttctttcctattcagaaactaaa |
40 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
5080343 |
actaaaataacgacttctttcctattcagagactaaa |
5080379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 266 times since January 2019
Visitors: 5834