View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0808_low_55 (Length: 251)
Name: NF0808_low_55
Description: NF0808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0808_low_55 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 47933853 - 47934093
Alignment:
| Q |
1 |
cccttctagaacatcggttgagggtttcgtcattgttagtgctactacctcgccattacccctgacagttattttcgaatataccagttttgatgcaatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
47933853 |
cccttctagaacatcggttgagggtttcgtcattgttagtgctactacctcgccaatacccctgacagttattttcgaatataccagctttgatgcaatg |
47933952 |
T |
|
| Q |
101 |
gtaaagttgctgtcacgtaactaaaagggtatttaggtcttgagaacaccctctggtgtaaacaacacggaagcagcgcacaatataccaattgattgga |
200 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47933953 |
gtaaagttgttgtcacgtaactaaaaaggtatttaagtcttgagaacaccctctggtgtaaacatcacggaagcagcgcacaatataccaattgattgga |
47934052 |
T |
|
| Q |
201 |
cccccttcctagaacggctcatttactagaacggctctctg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
47934053 |
cccccttcctagaacggctcatttactagaatggctctctg |
47934093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 362 times since January 2019
Visitors: 5835