View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0808_low_56 (Length: 251)
Name: NF0808_low_56
Description: NF0808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0808_low_56 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 5946109 - 5945872
Alignment:
| Q |
1 |
catgtcagcatttgctcgtcttactagtgggattggactacgaagtcccccaaatgagcttgctacgagcagttcaggagccgagcaacctaatataatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5946109 |
catgtcagcatttgctcgtcttactagtgggattggactacgaagtcccccaaatgagcttgctacgagcagttcaggagccgagcaacctaatataatt |
5946010 |
T |
|
| Q |
101 |
gaatcattcactaaagggttggtggactcttcaaaggaagcagtaaaggcagtgcagaccaaagcacggcatattgtttctcaaaataaacgcagatacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5946009 |
gaatcattcactaaagggttggtggactcttcaaaggaagcagtaaaggcagtgcagaccaaagcacgacatattgtttctcaaaataaacgcagatacc |
5945910 |
T |
|
| Q |
201 |
aggtcagtcaacaatttacacctgcttcaattttgcct |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5945909 |
aggtcagtcaacaatttacacctgcttcaattttgcct |
5945872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 161 - 204
Target Start/End: Complemental strand, 48864611 - 48864568
Alignment:
| Q |
161 |
aaagcacggcatattgtttctcaaaataaacgcagataccaggt |
204 |
Q |
| |
|
||||| || ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
48864611 |
aaagctcgacatgttgtttctcaaaataaacgcagataccaggt |
48864568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 558 times since January 2019
Visitors: 5844