View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0808_low_58 (Length: 251)
Name: NF0808_low_58
Description: NF0808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0808_low_58 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 43619074 - 43618837
Alignment:
Q |
1 |
cttgcagttgtgtgtgaatttcagtggaacaaaaataaagttataataattttgatggttgaatacatgaatgaaataaagttattcttttgctaaatac |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
43619074 |
cttgcagttgtgtgtgaatttcagtggaacaaaaataaagttataataattttgatcgttgaatacatgaatgaaataaagttattcttttgataaatac |
43618975 |
T |
 |
Q |
101 |
atgatattttgttatgttccttgtttaggaagccatctagtggataatttttgcgtactttttcccttttaagaaatttgcaactgaaaattacattgtg |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43618974 |
atgatattttgttatgttccttgtttaggaagccatctagtggataatttttgcgtac--tttcccttttaagaaatttgcaactgaaaattacattgtg |
43618877 |
T |
 |
Q |
201 |
tattttatgtttgtgtgcagtttttaacattctttttcat |
240 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43618876 |
tattttatgtttgtgtgcagtttttaacattctttttcat |
43618837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 92 times since January 2019
Visitors: 5830