View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0808_low_62 (Length: 205)
Name: NF0808_low_62
Description: NF0808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0808_low_62 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 8e-91; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 18 - 202
Target Start/End: Complemental strand, 42604302 - 42604118
Alignment:
Q |
18 |
caaacttttgaaattgattgtttcggtgtgatattcaatctgtttctcttctttctcttagtttttaaaatataaatagaaatggcattatgaaaggata |
117 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
42604302 |
caaacttttgaaattgattgtttcagtgtgatattcaatctatttctcttctttctcttagtttttaaaatataaatagaaatgccattatgaaaggata |
42604203 |
T |
 |
Q |
118 |
gatggcaaggttggtggggctgaaaggcaaatacggatagatcgtttttaatgccaaaaattcaagattttgctttcttctttct |
202 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42604202 |
gatggcaaggttggtggggctgaaagacaaatacggatagatcgtttttaatgccaaaaattcaagattttgctttcttctttct |
42604118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 18 - 202
Target Start/End: Original strand, 49043630 - 49043818
Alignment:
Q |
18 |
caaacttttgaaattgattgtttcggtgtgatattcaatctgttt--ctcttctttctcttagtttttaaaatataaatagaaatggcattatgaaagga |
115 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
T |
49043630 |
caaacttttgaaattgattgtttcagtgtgatattcaatctgttttactcttctttctcttggcttttaaaatataaatagaaatggcattatgaaagga |
49043729 |
T |
 |
Q |
116 |
tagatggcaaggttggtggggctgaaaggcaaatacggatagatcgtttttaatgccaaaaa---ttcaagattttgctttcttctttct |
202 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
49043730 |
tagatggcaaggttggtggggctgaaagacaaatacggatagatcg-ttttaatgccaaaaattcttcaagattttgctttcttctttct |
49043818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University