View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0808_low_63 (Length: 204)
Name: NF0808_low_63
Description: NF0808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0808_low_63 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 931328 - 931425
Alignment:
| Q |
1 |
ctctgtgtaagggagataaggatgtagaagttaatatcactgagtgcaaaaattctggcaaagctttgatggtgttagatttcggtgaggatgatgtc |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
931328 |
ctctgtgtaagggagataaggatgtagaagttaatatcactgagtgcaaaaattctggcaaagctttgatggtgttagatttcggtgaggatgatgtc |
931425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University