View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809-Insertion-10 (Length: 255)
Name: NF0809-Insertion-10
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809-Insertion-10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 7 - 235
Target Start/End: Complemental strand, 11616624 - 11616404
Alignment:
| Q |
7 |
acaatgctcttagaaagttggtttttaagtatctgtttattcattatttttctcatatattgtaggtctcaatagttagggtgtccaaattcgttctatt |
106 |
Q |
| |
|
|||||||||||| |||||||||| || | ||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11616624 |
acaatgctcttaaaaagttggttgtttattatctgtttattcattatttttcacatatattgtaggtctcaatagttagggggtccaaattcgttctatt |
11616525 |
T |
|
| Q |
107 |
gtaggtttagcctagaaaagatccaaggcggtttcaaaaaacccactagggttatggttattttcg-nnnnnnnnncttctttaaatgggacaaacaagc |
205 |
Q |
| |
|
||||| || | | |||||||| |||||||||| |||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
11616524 |
gtagggtt---------atggtccaaggcagtttcaaaaagcccactagggttatagttattttcgttttttttttcttctttaaatgggacaaacaagc |
11616434 |
T |
|
| Q |
206 |
gaaaaaccctaaaacggttcacaaacaact |
235 |
Q |
| |
|
|||||||||||| || |||| ||||||||| |
|
|
| T |
11616433 |
gaaaaaccctaatactgttcccaaacaact |
11616404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4546 times since January 2019
Visitors: 5751