View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809-Insertion-11 (Length: 221)
Name: NF0809-Insertion-11
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0809-Insertion-11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 4e-77; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 8 - 165
Target Start/End: Original strand, 31879777 - 31879934
Alignment:
Q |
8 |
agaaacacatgcatttgtcaggtcgtctttgcttattttaaatattgtcaatttacgtggatctatatctcataacataggaaaaatgacgagtattata |
107 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |
|
|
T |
31879777 |
agaaacacatgcatttgtcaggtcgtctttgcttattttaaatattgtcaatttacgtggatctatatctcatgacataggaaaaatgacgagtatttta |
31879876 |
T |
 |
Q |
108 |
attttcacgagccaaatgagctagatcacatttttgtaatattacaaataaataaatg |
165 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
31879877 |
attttcacgagccaaatgagctaggtcacatttttgtaatattacaaataaataaatg |
31879934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 192 - 221
Target Start/End: Original strand, 31880287 - 31880316
Alignment:
Q |
192 |
atagtgtgaatgttcaaggaaacttcttac |
221 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
31880287 |
atagtgtgaatgttcaaggaaacttcttac |
31880316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University