View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809-Insertion-15 (Length: 102)
Name: NF0809-Insertion-15
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0809-Insertion-15 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 5e-47; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 5e-47
Query Start/End: Original strand, 8 - 102
Target Start/End: Complemental strand, 33488851 - 33488757
Alignment:
Q |
8 |
tcttcatgtgcttctgctgctgagagaaaatcgttgaaagatgaggaagctctgaaagatgacgagagtgtattggaatcgagggtttgtgtgga |
102 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33488851 |
tcttcatgtgcttctgctgctgagagaaaatcgttgaaagatgaggaagctctgaaagatgacgagagtgtattggaatcgagggtttgtgtgga |
33488757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University